60-second symptom check

Which program does your pattern look like?

Fatigue, sleep, mood, libido, weight and focus are often connected. Tap what you've been noticing to see which of our five programs your symptoms most resemble.

Tap everything that sounds familiar

HormonesMetabolismThyroid & stressProactive

Your read

0 bp

— — —

Pick what you’ve been feeling. We’ll show which of the five programs your pattern most resembles, and you can bring it to a free 15-minute discovery call.

The four programs

Learn more about the symptoms we evaluate or how our lab testing works.

Hormonal Wellness
4 months · Hormone symptoms, no other conditions
ATGGTGATCACCGCCCTGAT
Focused hormone evaluation and care for symptoms such as fatigue, sleep changes, mood or low libido, for people without other medical conditions or weight concerns.
Vital Wellness
4 months · Hormone and weight concerns
ATGGTGATCACCGCCCTGAT
An integrative, functional medicine plan for hormone and weight concerns in people without other medical conditions, with functional labs and a health coach.
Restore Wellness
6 months · Weight plus medical conditions
ATGGTGATCACCGCCCTGATTACTTACATG
A six-month plan for hormone and weight concerns plus conditions such as high blood pressure, high cholesterol, diabetes, digestive issues or Hashimoto’s.
Longevity Wellness
9 months · Complex or ongoing concerns
ATGGTGATCACCGCCCTGATTACTTACATGGTGATCACCGCCCTG
The same depth as Restore, with nine months of physician oversight, coaching and follow-up for ongoing or complex health concerns.
Vibrant Wellness
12 months · Several conditions, longest support
ATGGTGATCACCGCCCTGATTACTTACATGGTGATCACCGCCCTGATTACTTACATGGTG
Twelve months of personalized, physician-led care for several health issues at once, such as high blood pressure, diabetes, high cholesterol, hormonal disorders or difficulty losing weight.

Programs are tailored for women and men, and your evaluation decides which one fits.

Women’s programs Men’s programs Compare all five →

Your first step

Start with a free 15-minute discovery call.

Step 1Free 15-minute discovery callTell us what's going on. We'll explain how the programs work and whether we're a fit.
Step 2Evaluation and advanced labsHormones, metabolism, thyroid, micronutrients and inflammation, plus your full history.
Step 3Physician review and your planDr. Tancinco reads the results with you and recommends a program built around them.

Prefer to call? Arkansas 501-254-9650 · Miami 786-473-4815

Cash-based practice: we don't bill insurance. HSA/FSA cards (where your plan allows) and CareCredit financing are accepted.

Discovery call request

Free · 15 min · no obligation